Divers Sources et Références Pétitions Liste de Diffusion Nous contacter Documents Liens Back home page FAQ Home Page Association FABULA Forums
Chapitres ¬
• Evolution & Cladistique
• Preuves de l'Évolution I
• Preuves de l'Évolution II
• Preuves de l'Évolution III
• Preuves de l'Évolution IV
• Preuves de l'Évolution V
• Preuves de l'Évolution VI
• Preuves de l'Évolution VII
• Preuves de l'Évolution VII
• Preuves de l'Évolution IX
• Homo et autres Primates
• 2 espèces & Néoténie
• Phylogénie & Règnes
• Arthropodes & Diversité
• Tétrapodes & Oiseaux
• Archaeopteryx controversé
 
Voir aussi ¬
• Dogme & Sciences
• Neurologie & Croyances
• La Théorie Darwinienne
Gorilla gorilla & baby

Que l'Homme soit un primate parmi tant d'autres semble être le plus insupportable et inacceptable aux yeux des religieux conservateurs. Une proposition inique pour les créationnistes, qui iront parfois jusqu'à consacrer leur vie à tenter de trouver des failles dans les modèles évolutionnistes.
«C'est à cause du poil et des poux. Ils grattent et ils dérangent», me dit un jour mon frère José, un grand savant.

L'Homme, un Primate parmi les autres

Le cladogramme de cette page est une proposition de reconstitution de la parenté entre les diverses lignées de primates et, comme dans tout cladogramme, le fait qu'une espèce soit située à une extrémité (Homo sapiens situés en bas à gauche) n'est pas l'indication d'un aboutissement ni d'une quelconque hiérarchie de complexité. N'importe quelle autre espèce de primate aurait pu servir de fil rouge à détailler, et son taxon serait alors situé en bas de page, à la place de l'Homo sapiens, selon une même structure graphique. [ Détails sur cladogrammes ]. Afin de mieux utiliser ce cladogramme, il est important de bien comprendre que les caractères morphologiques, génétiques ou comportementaux proposés à la racine de chaque taxon, sont hérités et normalement partagés par tout le groupe inféodé. Les caractères proposés ne sont pas exhaustifs ; il s'agit d'une sélection parmi un éventail de caractères dérivés parfois très large.

=

 

Le taxon des Euarchontoglires auquel appartiennent les Primates

Cette nouvelle classification est confortée par de nombreux caractères dérivés (notamment par un pénis pendant), les restes fossiles, et la comparaison de séquences d'ADN (F. Delsuc, J-F. Mauffrey, E. Douzery, 2003). Les différents ordres de mammifères restent bien définis mais les relations de parenté entre eux ont été revues et corrigées : similaire à l'ancienne phylogénie, cette nouvelle classification phylogénique apporte quelques modifications de détail sur les origines des différents grands groupes de placentaires, et sur les parentés entre ordres, dont certaines éclatent (Insectivores). L'ordre des Chiroptères par exemple, est écarté du taxon qui comprenait les Primates: l'ancienne dénomination Archonta disparaît donc, et les Primates sont actuellement situés dans un arbre remodelé, comprenant aussi les Glires (Rongeurs et Lagomorphes). Bien entendu, des controverses existent sur les relations entre taxons.

Euarchontoglires
PrimatesScandentes Dermoptères Glires

Lémurs, singes, humains

Tupaïes

Galéopithèque, Colugo

Rongeurs, Lapins, Pikas

Ceci mis à part, l'ancêtre commun à tous les primates actuels, aussi étrange que cela puisse paraître, est mieux connu par son caryotype - reconstitué par diverses techniques (1) - que par son apparence physique dont on ne peut que faire des suppositions (il n'y a pour l'instant pas de bon candidat fossile) ! Ci-dessous un clade simplifié des primates actuels, où seules les subdivisions menant à l'homme seront détaillées.

Les principales caractéristiques morphologiques des primates

Les primates ont les caractéristiques suivantes (en plus des caractéristiques communes à tous les autres mammifères et vertébrés) :

PurgatoriusCaractères anciens conservés :
¬ Clavicules et membres à 5 doigts
¬ Denture complète non spécialisée
Caractères évolués:

¬ Os du bras mobiles : radius et cubitus
¬ Os de la jambe séparés : tibia et péroné
¬ Pouces opposables et ongles plats (au lieu de griffes)
¬ Inclusion des testicules dans le scrotum
¬ Bulle tympanique formée à partir de l'os pétreux (ou rocher)
¬ Coussinets tactiles ridés au bout des doigts (dermatoglyphes)
¬ Calcaneum allongé dans sa partie distale
¬ Réduction du museau et de l’olfaction
¬ Urètre et vagin complètement séparés chez les femelles
¬ Masse cérébrale relativement élevée chez les nouveau-nés et les fœtus
¬ Gestation relativement longue et vie postnatale prolongée
¬ Présence d’une barre post-orbitaire (jonction des os frontal et zygomatique)

¬ 1 seule paire de mamelles
¬ Orientation frontale des orbites : vision binoculaire
¬ Développement de l'encéphale à nombreuses circonvolutions de surface (gyrencéphales)

 

Les différents taxons de primates actuels et leurs principales spéciations

Ce tableau suit une hiérarchie systématique. Les taxons subalternes ont les caractéristiques communes au taxon auquel ils sont inféodés ainsi que leurs caractéristiques propres, précisées en dessous. Nous allons suivre en détail le taxon dont font partie les humains, étayé et par les accidents chromosomiques reconstitués (en rouge) et par certains caractères morphologiques (en brun).


Nous pouvons d'abord diviser les primates en deux groupes différents, ou taxons:
HaplorrhiniStrepsirrhini
Voir un exemplaireVoir un exemplaire Voir un exemplaire

Le sous-ordre des HAPLORRHYNIENS

¬ Nez simple: fente antérieure fermée, narine ronde, peau sèche, pilosité apparente, lèvre supérieure très mobile, absence de vibrisses

et le sous-ordre des STREPSIRHINIENS
(Lémuriens et Loris)

¬ Nez à l'aspect de truffe : peau humide, fente latérale, profond sillon en avant, lèvre supérieure peu mobile
¬
Orbite oculaire ouverte
Accidents chromosomiques:
¬ Fissions


Parmi les Haplorrhyniens nous trouvons deux taxons:
SimiiformiTarsiiformi
Voir un exemplaireVoir un exemplaireVoir un exemplaire

et l'infra-ordre des SIMIIFORMES

¬ Orbite oculaire parfaitement fermée
Accidents chromosomiques:
¬ Translocation robertsonienne et autre transloc.

L'infra-ordre des TARSIIFORMES
(Tarsiers)

¬ Extrémités des doigts élargies faisant office de ventouses
¬ Hypertrophie des yeux
¬ Tibia et péroné partiellement fusionnés


Parmi les Simiiformes nous trouvons deux taxons :
CatarrhiniPlatyrrhini
Voir un exemplaireVoir un exemplaireVoir un exemplaire

et le groupe des CATARRHINIENS

¬ Cloison nasale étroite, aux narines rapprochées s'ouvrant vers le bas
¬ 2 prémolaires (disparition de la 3me)
¬ Placenta discoïde, cycle ovulatoire de 28 jours.
¬ Queue non préhensile
¬ Grand dimorphisme sexuel selon les espèces
Accidents chromosomiques:
¬ Translocations robertsoniennes et autre transloc.
¬ Réarrangement complexe
¬ Inversions péricentriques

Le groupe des PLATYRRHINIENS
(Singes sud-américains)

¬ Large cloison nasale, nez aplati aux narines s'ouvrant vers l'extérieur
¬ 3 prémolaires conservées
¬ Queue souvent préhensile
¬ Réduction parfois extrême du pouce de la main.
Accidents chromosomiques:
¬ 1 translocation robertsonienne
¬ 1 inversion péricentrique


Le caryotype reconstitué de l'ancêtre commun aux catarrhiniens (macaques, grands singes, homme) :

On observe que cet ancêtre avait beaucoup de chromosomes et portions de chromosomes en commun avec l'homme moderne (HSA). Seule inconnue majeure : le chromosome 3 était soit comme celui de l'orang-outan actuel (PPY), soit comme celui de macaque (MMU).
L'animal dont le caryotype est représenté a vécu il y a 30 à 50 millions d'années, et du fait que les chromosomes possèdent des structures en bandes, il est possible de reconstituer les réarrangements qu'ils subissent. Idem pour identifier les étapes intermédiaires lorsqu'un chromosome subit plusieurs modifications. Ces étapes reconstruites permettent de fixer ce qui est ancestral et ce qui est dérivé.

Légende
CCACapucin
MMUMacaque
PPYOrang-Outan
HSAHomo sapiens

 

Parmi les Catarrhiniens nous trouvons deux taxons:

HominoideaCercopithecoidea
Voir un exemplaireVoir un exemplaireVoir un exemplaire

et la super famille des HOMINOÏDÉS

¬ Disparition totale de la queue externe
¬ Ectotympanique en tube
¬
Maxillaire saillant
¬ Nette séparation du pouce et de l'index
Accidents chromosomiques:
¬ Inversions péricentriques et autres inversions

La super-famille des CERCOPITHECOÏDÉS
(Macaques, Mandrills)

¬ Molaires à 4 tubercules reliées 2 à 2 par des crêtes
¬ Ectotympanique en anneau
Accidents chromosomiques:
¬
Inversions péricentriques et autres


Gorilla squeletonRécapitulons, les Hominoïdes sont donc caractérisés par :
¬ Disparition totale de la queue externe, maxillaire saillant, nette séparation du pouce et de l'index
... mais aussi par :
¬ Larges épaules et poitrine plus large qu'épaisse : omoplates déplacés vers l'arrière et colonne vertébrale rapprochée du sternum
¬ Sternum élargi et tendant à devenir rigide par la fusion des segments intercostaux
¬ Nombre des vertèbres thoraciques réduit (19 à moins de 17)
¬ Nombre des vertèbres sacrées augmenté
¬ Cerveau plus important à structure plus complexe
¬ Période de gestation et développement des jeunes très longs
¬ Caecum réduit en simple appendice, présent entre les intestins gros et grêle
¬ Facilités anatomiques pour la démarche bipède


Les Hominoidea comprennent deux taxons:
Hylobates moloch
Voir un exemplaireVoir un exemplaireVoir un exemplaire

et la famille des HOMINIDÉS

¬ Grande taille, bras moins longs, origine africaine
¬ Absence de callosités ischiatiques
¬ Adaptations vers une vie plus terrestre et/ou acquisition de la bipédie au sol, et/ou "knuckle-walking".
¬ Utilisation et modification d'ustensiles (cailloux et bâtons ou tiges).
¬ Traces de transmission culturelle tribale, et de codes de langage.
Accidents chromosomiques:
¬ Inversions péricentriques et autres

La famille des HYLOBATIDÉS

¬ Comprend une douzaine d'espèces toutes asiatiques, divisées en 4 genres, les Gibbons, Hoolock et Siamang.
¬ Bras et mains extrêmement allongés, en faisant les champions de la brachiation.
¬ Démarche bipède au sol et sur les branches, leurs longs bras servant de balanciers.
¬ Structure du poignet particulière.


La famille des Hominidés comporte 5 espèces actuellement vivantes:
LucyPan paniscusGorilla gorilla
Voir un exemplaireVoir un exemplaireVoir un exemplaire
Pongo pygmaeus
Voir un exemplaireVoir un exemplaireVoir un exemplaire

Le taxon des HOMININÉS

¬ Comprend les Hommes, le Bonobo et le Chimpanzé.

Le taxon des GORILLINÉS

¬ Une seule espèce (et 3 variétés géographiques), le Gorille (Gorilla gorilla), aussi débonnaire et pacifique quel que soit son habitat.
¬ Polygame et vivant en petits groupes familiaux, la taille du gorille mâle est très variable mais dépasse souvent les 200 kilos (et plus de 700 cm3 pour le cerveau) !

Accidents chromosomiques:
¬ Inversions péricentriques et autres inversions
¬ Modification de l'hétérochromatine
¬ 1 translocation

Le taxon des PONGINÉS

¬ Représentée par une unique espèce asiatique (à 2 variétés géographiques), l'Orang-outan (Pongo pygmaeus)
¬ Disque facial caractéristique chez le mâle.
Accidents chromosomiques:
¬ Inversions péricentriques



Voir un exemplaireVoir un exemplaireVoir un exemplaire

Voir un exemplaireVoir un exemplaireVoir un exemplaire

Les Homo et genres apparentés

¬ Avec plusieurs genres et espèces éteintes
¬ Suture incisive entre le maxillaire et le prémaxillaire s'estompant chez l'adulte.
¬ Bassin plus court et élargi.
Accidents chromosomiques:
¬ Inversions péricentriques et autres inversions
¬ 1 translocation
¬ Modification de l'hétérochromatine

Le Bonobo (Pan paniscus)

¬ Une seule espèce, très récemment distinguée de son proche cousin troglodytes.
¬ Sexualité débridée assez remarquable: le bonobo semble pacifier son irritabilité par la pratique d'une sexualité très diverse et fréquente, avec ses congénères.
Accidents chromosomiques:
¬ Inversions péricentriques et autres inversions
¬ Modification de l'hétérochromatine

 

Le Chimpanzé (Pan troglodytes)

¬ Une seule espèce à plusieurs variétés géographiques, et variabilité morphogénétique conséquente entre individus.
¬ La taille du chimpanzé adulte est elle aussi particulièrement variable, allant d'une vingtaine de kgs à plus de 90 kgs chez certains mâles fort costauds.
Accidents chromosomiques:
¬ Modification de l'hétérochromatine


À partir d'ici, nous intégrons les espèces disparues, soeurs de la lignée humaine, dans le cladogramme ; et marquerons les noeuds de leur séparation par des détails anatomiques et/ou par des caractères éthologiques déduits des traces fossiles.
Les différences entre espèces sont,
vu leur proximité, le manque de pièces disponibles et leur état de fossiles, de moins en moins évidentes, on se satisfera donc de déductions basées sur les proportions et la forme du squelette, l'âge des fossiles et leur localisation géographique, ainsi que d'analyses très pointues du matériel à disposition.

Théorie du développement et néoténie.
Les embryologistes ont mis en évidence une chronologie du développement embryonnaire et insistent aujourd'hui sur la valeur évolutive que peut avoir l'altération de la chronologie du développement.. Les altérations pouvant concerner la vitesse (accélération, ralentissement), la durée (hypomorphose, hypermorphose), le "top" du début de développement qui peut être avancé ou retardé.
Une hypothèse solidement documentée : Tandis que le crâne du (proto) chimpanzé va changer de forme en grandissant - face de plus en plus saillante et crâne proportionnellement de moins en moins globuleux, le genre (proto) Homo aurait conservé sa forme juvénile au stade adulte - front bombé, arrière du crâne très rond, face petite et placée sous le crâne... On suppose donc que la croissance humaine s’est « ralentie » par rapport au modèle ancestral ressemblant au chimpanzé, le ralentissement s’accompagnant d’un allongement des différentes phases de la croissance. Ainsi, l'Homme devient sexuellement mature plus tard que le chimpanzé. [ Détails sup. sur néoténie ]. Cette hypothèse (la néoténie de l'humain) est un peu tombée en désuétude, notamment car certains éléments pointent vers d'autres raisonnements ou processus (le développement des membres par ex.). Il reste néanmoins que les hétérochronies (dont la néoténie est un cas particulier) sont un élément explicatif fort des différences phénotypiques interlignées, à ne surtout pas balayer à la légère (cf: P. Picq qui semble trop empressé de mettre la néoténie aux oubliettes...), et dont le substrat peut être très divers (environnement et accidents embryonnaires, génétique, etc.).

Ce taxon comprend 7 genres, dont une seule espèce encore vivante :

Homo erectusHomo habilis
Voir un exemplaireVoir un exemplaireVoir un exemplaire

Australopithecus
Voir un exemplaireVoir un exemplaireVoir un exemplaire

Ardipithecus
Voir un exemplaireVoir un exemplaireVoir un exemplaire

Les Homo proches sapiens

¬ La tendance s'accentue vers un cerveau plus conséquent et une corpulence plus gracile (de coureurs de fond ?).
¬ Nouveaux climats, nouvelle alimentation plus riche.

Homo habilis, H. rudolfensis

¬ Apparus en Afrique de l'Est il y a 2,5 MA.
¬ Cerveau plus gros que les australophitéciens, avec mâchoire plus modeste et face plus plate, capacité crânienne de 550 à 750 cm3.
¬ Premières techniques de taille de pierre et premières cabanes sommaires.

Australopithecus, Paranthropus, Kenyanthropus

¬ Bassin élargi, supportant les organes internes, et genou, démontrent une bipédie bien maîtrisée, combinée à une aptitude au grimper de leurs pieds.
¬ Crâne et appareil masticatoire très robustes, molaires massives recouvertes d'émail.
¬ Cerveau de 380 à 600 cm3.

Ardipithecus (*), Orrorin, Sahelanthropus

¬ Fémur très rectiligne d'Orrorin, démontrant qu'il marchait bien droit. De récentes études sur Ardipithecus démontrent aussi sa posture et démarche bipède.
(*) Certains auteurs considèrent Ardipithecus comme lignée soeur de pré-chimpanzés plutôt que de pré-hominiens.


Hypothèses récentes.
- Le crâne des espèces ci-dessous pourrait devoir sa forme à la mutation de la mysosine, protéine musculaire devenue moins efficace il y a 2,4 MA : les muscles de la mâchoire auraient diminué de volume et permis la réorganisation des os du crâne des Homo ultérieurs.

- La comparaison du développement des dents d' Homo erectus et du chimpanzé moderne montre qu' H. erectus grandissait aussi vite qu'un chimpanzé, ce qui ne lui aurait pas permis d'acquérir un langage articulé complexe au vu de la position du pharynx consécutive à ces données.
- Depuis 1977, Homo neanderthal et H. sapiens sont considérés comme deux espèces distinctes par la majorité des paléoanthropologues, suite à des études moléculaires effectuées sur un fossile néandertalien âgé de 50 000 ans : des biologistes allemands ont pu en extraire un fragment d'ADNmt étonnamment conservé, formé d'une séquence de plus de 300 nucléotides. La comparaison avec l'homme actuel, compte tenu des vitesses moyennes de mutations qui transforment naturellement l'ADN, a fait conclure le paléogénéticien S. Paäbo à l'impossibilité pour l'homme contemporain de descendre de Neandertal, la distance génétique étant en effet trop grande pour cela, d'où la légitimité de considérer les Neandertal comme faisant partie d'une espèce d'homme originale. Cette première étude a été confirmée par une autre (sur un autre fossile), alors que d'autres études ultérieures arrivent à la conclusion que ces expertises ne permettent pas encore de trancher définitivement. [ Détails sur Néandertal ]
- En 2006, deux découvertes indépendantes par différentes équipes, à quelques semaines d'intervalle. Portant toutes deux sur des gènes semblant déterminants pour la taille du cortex cérébral. Le gène HAR1F par exemple, pourrait être impliqué dans la taille du cortex cérébral humain, qui a été multipliée par 3 par rapport au chimpanzé et l'australopithèque. En quelques millions d'années seulement, une région du génome humain semble avoir évolué près de 70 fois plus vite que le reste de notre code génétique.
David Haussler, coauteur de l'étude, a étudié les 49 régions du génome ayant le plus changé entre le singe et l'homme, et a porté toute son attention sur une zone spécifique dont le changement a été très important dans un temps relativement court. Ce gène qui n'existait pas il y a 300 millions d'années, n'est présent que chez les mammifères et les oiseaux. Les poissons et les invertébrés n'en possèdent pas. S'il ne présente pas de grands changements entre différentes espèces, il n'existe que deux différences entre le chimpanzé et une volaille, il en existe 18 entre l'homme et le chimpanzé, toutes vraisemblablement apparuees au cours du développement de l'homme.

 

Homo sapiens
Voir un exemplaireVoir un exemplaireVoir un exemplaire
Homo neanderthalensis
Voir un exemplaireVoir un exemplaireVoir un exemplaire
Homo heidelbergensis
Voir un exemplaireVoir un exemplaireVoir un exemplaire
Homo erectus
Voir un exemplaireVoir un exemplaireVoir un exemplaire

Homo sapiens sapiens
(l' Homme moderne)

¬ Capacité crânienne moyenne de 1450 cm3 (mâles). Complexion plus fine que Néandertal, menton plus affirmé, arcades sourcilières moins accusées, front relevé, taille très variable de 1,60 m à 1,88 m.
¬ Homo sapiens et neanderthal vont longtemps se "côtoyer" en Palestine, depuis (-100 000 à - 50 000 ans), mais aucune preuve de contacts, d'échanges, ni de cohabitation entre eux n'a été confirmée par la paléo. La génétique a en revanche confirmé des traces de flux génétique assez récent entre sapiens et neandertalensis.
¬ Peintures rupestres, autres technologies et coutumes similaires aux néandertaliens. Les sapiens prendront le relais de toutes ces inventions en les améliorant jusqu'à nos jours.

Homo (sapiens) neanderthalensis

¬ Capacité crânienne de 1570 cm3 (mâles), crâne dolichocéphale au volume supérieur à sapiens, front bas et menton fuyants, bourrelet sus-orbitaire saillant, et bourrelet occipital caractéristique. Corpulence et complexion très robustes, taille très variable, moyenne de 1,65 m pour les mâles et 1,55 m pour les femelles.
¬ Enterrements et rites funéraires, soin des blessés, outils avancés (bifaces et sagaies, pointes en os, travail sur bois et ivoire), art décoratif et vestimentaire, musique (flûte), habitats mobiles recouverts de peaux.
¬ Disparition pour causes inconnues, plus progressive que soudaine. Traces de carences alimentaires et de vie très rude (nombreux os fracturés).

Homo heidelbergensis, H. antecessor, H. georgicus

¬ Ces 3 espèces sont toutes 3 peu ou prou l'archétype des fossiles de transition entre les erectus et les hommes modernes. Parfois appelés "erectus évolués" ou "sapiens archaïques" selon l'auteur, ils montrent bien une continuité évolutive ô combien difficile, du point de vue paléontologique, à reconstituer. Même difficulté pour déterminer une limite franche entre des espèces soeurs dont certaines, très polymorphes, se succèdent parfois ou cohabitent.
Si les intermédiaires structuraux sont bien visibles dans le registre fossile des hominiens, le travail de reconstitution reste néanmoins très complexe.

Homo erectus, H. floresiensis (*), H. ergaster

¬ Molaires plus petites, à fine couche d'émail, larges incisives: alimentation plus riche et variée, plus carnée , remplaçant l'ancien régime (végétaux durs et fibreux) de H. habilis.
¬ Boîte crânienne de 800 à 1100 cm3.
¬ Première maîtrise du feu, premières habitations perfectionnées protégeant du froid et des intempéries.
¬ Quittent le berceau africain et se dispersent en Europe et Asie.

Une bonne partie des fossiles d'Erectus ont récemment été renommés et classifiés comme espèces à part entière. Ces changements sont néanmoins âprement discutés.

(*) H. floresiensis est soupçonné par certains chercheurs d'être un H. sapiens pygmée et/ou ayant souffert d'une forme complexe de microcéphalie ; sa position restant très polémique de par sa combinaison de caractères dits primitifs, d'autres modernes et d'autres spécifiques.

 

Les divers cladogrammes des Hominidés actuels

Le cladogramme B est le plus récent, c'est aussi le plus remarquable: il rend les chimpanzés encore plus proches des hommes et réciproquement. Bien entendu, cette toute nouvelle classification n'est pas encore acceptée par tous les spécialistes (elle bouleverse peut-être trop notre orgueil d'humains), mais est de plus en plus consensuel - les indices s'accumulant tous dans ce même sens (B). Observons nénmoins qu'une très proche similitude et parenté génotypique (B) entre les Humains et respectivement Chimps, Gorilles et Orangs, a néanmoins produit d'assez fortes différences morphoanatomiques entre eux, du moins sur l'aspect de visu.


Cladogramme A
résultant de la comparaison de caractères morphologiques et anatomiques
A - Séparation entre le groupe des Homininae et Paninae
B - Séparation entre le groupe des Pongo et des Pan + Gorilla
C - Séparation entre Gorilla et Pan
D - Séparation entre troglodytes et paniscus



Cladogramme B
prenant en considération la comparaison du caryotype et les données d'analyses moléculaires
A - Séparation du groupe des Ponginae
B - Séparation entre les Gorillinae et les Homininae
C - Séparation entre les Homo et les Pan
D - Séparation entre troglodytes et paniscus

 

 

Comparaison moléculaire de l'Homme et du Chimpanzé

La comparaison des séquences de l'hémoglobine met en évidence les très grandes ressemblances entre Primates. Par ailleurs on remarque que les séquences sont identiques chez l'Homme et chez le Chimpanzé.
Par la comparaison de la séquence de N.A.D.-déshydrogénase on a reconstitué la séquence théorique de l'ancêtre commun. Le nombre de mutations en commun, à partir de cette séquence "d'origine" sont au plus élevé entre Homme et Chimpanzé, mais au plus faible entre Homme et Orang-outan.
La comparaison du nombre de mutations communes à deux espèces à partir de la séquence ancestrale la plus probable permet d'évaluer leur degré de parenté.

On peut aussi comparer les molécules grâce aux distances immunologiques : on immunise un lapin contre des protéines d'une espèce A puis on en prélève le sérum produit et on le met en présence de protéines d'une autre espèce B. Il se produit alors des réactions antigène-anticorps qui sont d'autant plus fortes que la différence entre espèces est faible.
De toutes ces comparaisons moléculaires, il ressort une remise en cause nette de la classification traditionnelle Pongidae-Hominidae, les Chimpanzés étant bien trop proches de l'homme...
D'autres classifications ont donc été établies grâce aux données moléculaires selon un ordre cette fois plus phylogénétique que phénétique.

Comparaison d'ADN mt de quelques Primates:

 Caractères 234567890123456789012345678901234567890123456
Taxa AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
1   Homo sapiensAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACA
2  PanAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACA
3  GorillaAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACA
4  PongoAGCTTCACCGGCGCAACCACCCTCATGATTGCCCATGGACTCACA
5  HylobatesAGCTTTACAGGTGCAACCGT CCTCATAATCGCCCACGGACTAACC
6  Macaca fuscataAGCTTTTCCGGCGCAACCATCCTTATGATCGCTCACGGACTCACC
7  M. mulattaAGCTTTTCTGGCGCAACCATCCTCATGATTGCTCACGGACTCACC
8  M. fascicularisAGCTTCTCCGGCGCAACCACCCTCATAATCGCCCACGGGCTCACC
9  M. sylvanusAGCTTCTCCGGTGCAACTATCCTTATAGTTGCCCATGGACTCACC
10  Saimiri sciureusAGCTTCACCGGCGCAATGATCCTAATAATCGCTCACGGGTTTACT
11  Tarsius syrichtaAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACC

 

 

Comparaison du caryotype de l'Homme et du Chimpanzé

Les caryotypes de l'homme et des chimpanzés se ressemblent énormément : l'homme et le chimpanzé ont en commun plus de 99 % de leur matériel génétique. Ils ont donc un proche ancêtre commun que l'on essaye de retrouver : sans doute une espèce à 48 chromosomes avec un caryotype proche de celui du chimpanzé.

Le chimpanzé (à gauche) possède 2n = 48 chromosomes (n = 24 chr.) tandis que l'homme (à droite) possède 2n = 46 chromosomes (n = 23 chr.). Pourtant il y a de fortes ressemblances entre les chromosomes des deux espèces :
13 paires de chromosomes sont identiques
(3, 6, 7, 8, 10, 11, 14, 16, 19, 20, 21, 22, 23 :X ou Y), soit plus de la moitié du total (26/48 = ± 54,2 %).
Les différences sur les chromosomes non-identiques sont dues à :
- des inversions autour du centromère dans le cas des chr. 4, 9, 12, 17 ;
- l'adjonction d'un segment : chr. 1, 13, 18 ;
- la translocation (fusion de deux chromosomes au niveau du centromère) : 2p et 2q en le chromosome 2 de l'homme ;
- et quelques autres plus complexes: 9, 15.

 

 

Comparaison ontogénique de l'Homme et du Chimpanzé

La gestation dure 8 mois chez le chimpanzé contre 9 mois chez l'homme, cependant que la vie embryonnaire est de 2 semaines chez le chimpanzé contre 4 semaines chez l'homme.
Durant cette période le nombre de cellule nerveuses est alors considérablement augmenté chez l'homme, le cerveau est plus volumineux et son plan d'organisation semble plus complexe.
La vie foetale dure 7 mois 1/2 chez le chimpanzé et 7 mois chez l'homme.
En d'autres termes, le bébé humain naît "prématurément". Cela permet au crâne du bébé humain de passer par le canal obstétrical à la naissance, avant que le diamètre de son crâne de soit trop gros.
¬ Par conséquent, malgré un cerveau de 380 cm3 de moyenne chez le bébé humain contre 170 cm3 chez le bébé chimpanzé, les aptitudes psychomotrices du bébé humain sont plus réduites à la naissance : activités motrices volontaires, vision peu étendue et confuse, registre auditif étroit...
La phase lactéale est d'environ 3 ans chez le chimpanzé contre 6 ans chez l'homme.
Durant cette phase lactéale, le cerveau continue son développement très rapide ; la myélinisation des fibres nerveuses s'achève, et les connexions entre les cellules nerveuses du cortex se multiplient.
¬ Le volume cérébral croît donc de manière plus importante chez l'humain (3,5 fois chez l'homme contre 2,3 fois chez le chimpanzé) aidé de surcroît par la souplesse des jointures entres les os du crâne et par les fontanelles qui se referment vers 3 ans ches le bébé humain contre 8 mois pour le bébé chimpanzé.
¬ Le cervelet se modifie en relation avec l'équilibration : acquisition de la verticalité et de la marche bipède vers 14 mois chez l'homme, contre 6 mois chez le chimpanzé.
¬ Le crâne se repositionne : vers 2 ans, le trou occipital dans l'axe de la colonne vertébrale avance de manière à se placer en position centrale; facilitant ainsi la marche bipède et abaissant le larynx, ce qui permet le langage articulé. Alors que chez le chimpanzé la nuque reste plate et le larynx demeure en position haute. Le trou occipital ne migrant pas sous le crâne. Puis, vers 3 ans, le petit chimpanzé perdra son inclinaison naturelle (aptitude enfantine) pour la bipédie.

La phase de substitution, c-à-dire la période de remplacement des dents de lait par les dents définitives, dure chez l'homme environ 8 ans, pour 5 ans chez le chimpanzé.
Durant cette phase, de nombreux caractères adultes se développent :
¬ Chez le chimpanzé, s'accentue un bourrelet sus-orbital (ou arcade sourcilière) et la face s'allonge vers l'avant, les crocs se développent (canines)... et le cerveau cessera son développement en volume. Le jeune humain connaîtra en revanche un rythme de développement bien plus lent, et de nombreux caractères ou traits juvéniles seront conservés. De plus, le petit humain bénéficie d'une période plus importante pour parfaire son apprentissage.
Bien entendu, chez ces deux espèces, les connexions cérébrales entre neurones continueront leur remodelage selon le besoin et intensité de mémorisation et d'apprentissage (plasticité). Ce processus, comme tous les autres cités, est homologue.
L'acquisition de la maturité sexuelle se fera vers 9 ans chez le chimpanzé et vers 14 ans chez l'homme.

 

 

Annexe. L'évolution des techniques d'étude du caryotype

Le caryotype peut s'étudier après culture de sang (lymphocytes) ou de peau (fibroblastes). Un prélèvement post mortem peut être réalisé, les fibroblastes pouvant survivre plusieurs jours après le décès.
- Jusqu'au début des années 1970, seul le nombre et la morphologie des chromosomes (position du centromère*) étaient analysés. Le marquage chromosomique par des bandes (R,G,Q,C) qui s'est développé en 1970, a complètement révolutionné la cytogénétique.
- A partir de 1973, des méthodes faisant intervenir un analogue de la thymidine, la 5-bromodéoxyuridine, a permis d'étudier en plus la chronologie de la réplication de l'ADN situé dans chaque bande.
- A partir de 1975, des méthodes se synchronisation ont été introduites, permettant d'obtenir des chromosomes étirés, où l'on pouvait dénombrer deux à trois fois plus de bandes (près de mille) par caryotype haploïde.
- Les années 1980 ont vu l'essor de l'hybridation in situ, dont les applications sont doubles pour l'étude de la phylogénie chromosomique :
1) un gène ou une séquence d'ADN donnée peut être détecté, et donc "suivi" d'une espèce à l'autre. Cette approche a largement confirmé les résultats chromosomiques rapportés ici;
2) un chromosome peut être peint, en utilisant un ensemble de sondes représentatives, qui seront révélées par une coloration différente du reste du caryotype. Ces sondes étant d'origine humaine, on peut ainsi pister l'équivalent ou les équivalents d'un chromosome humain chez de nombreuses espèces. Des hybridations croisées sont obtenues avec des espèces aussi éloignées que le bœuf, le lapin ou le chat. Elles portent le nom de ZOO-FISH (zoo-fluorescence in situ hybridization ). Autre développement, on peut peindre un chromosome et obtenir un marquage de l'ensemble du caryotype en utilisant le ZOO-FISH et des anticorps contre la 5-bromodeoxyuridine, que l'on a fait préalablement incorporer par les cellules.

* Un chromosome agrocentrique a une forme en V, son centromère est situé à une extrémité. Un chromosome est métacentrique lorsqu'il a une forme en X.

Rafael Terrón
&
Gino Pygmaeus

 

Sources ¬
- F. Richard, B. Dutrillaux, Cytogénétique Cellulaire, Genet, 1996
- Adolph H. Schultz, Les Primates, Rencontre éditions, 1972 (illustrations scannées)

Association FABULA
Association FABULA
- free of copyrights -
Veuillez simplement citer la source de ces documents si vous les utilisez
Merci !!